Journal: Synthetic Biology

Article Title: biGMamAct: efficient CRISPR/Cas9-mediated docking of large functional DNA cargoes at the ACTB locus

doi: 10.1093/synbio/ysaf003

Figure Lengend Snippet: biGMamAct plasmid library

Article Snippet: ACTB sgRNA cloning is achieved by annealing two ssDNA primers ( ACTB _For 5ʹ CACCGACAGCTCCCCACACACCAC 3ʹ and ACTB _Rev 5ʹ AAACGTGGTGTGTGGGGAGCTGTC 3ʹ) and subsequent ligation in a Bbs1-digested pX458 (Addgene #48138).

Techniques: Plasmid Preparation

Journal: Synthetic Biology

Article Title: biGMamAct: efficient CRISPR/Cas9-mediated docking of large functional DNA cargoes at the ACTB locus

doi: 10.1093/synbio/ysaf003

Figure Lengend Snippet: (a) biGMamAct assembly. GOIs inserted into the psLIB shuttle plasmids of the biGMamAct expression system can be PCR amplified using the standard bioinformatically designed primers of the biGBac system for further assembly into the recipient psBIG1a ACTB T2ATetP2AP-mAGH leading to all-in-one pDONOR generation. (b) KI design. Cotransfection of the pDONOR 6colors plasmid with a Cas9-containing one targeting ACTB locus will lead to pDONOR stable and precise integration via HITI at the ACTB locus with high efficiency. Indeed, ACTB sgRNA targeted sequence is present in reverse orientation in pDONOR for linearization by Cas9 endonuclease and orientation-controlled integration in the genome. sgRNA target sequence and resulting junctions are depicted (PAM is underlined, and DNA sequence from pDONOR in bold). (C) Cloning validation. Agarose gels showing recombining and positive pDONOR 6colors clones (left) and correct sgRNA ACTB cloning in pX458 (right).

Article Snippet: ACTB sgRNA cloning is achieved by annealing two ssDNA primers ( ACTB _For 5ʹ CACCGACAGCTCCCCACACACCAC 3ʹ and ACTB _Rev 5ʹ AAACGTGGTGTGTGGGGAGCTGTC 3ʹ) and subsequent ligation in a Bbs1-digested pX458 (Addgene #48138).

Techniques: Expressing, Amplification, Cotransfection, Plasmid Preparation, Sequencing, Cloning, Biomarker Discovery, Clone Assay

Journal: Molecular Therapy. Nucleic Acids

Article Title: CRISPR-Cas9-mediated reactivation of the uricase pseudogene in human cells prevents acute hyperuricemia

doi: 10.1016/j.omtn.2021.08.002

Figure Lengend Snippet: Schematic for CRISPR-Cas9-mediated knockin of exogenous DNA fragment into human AAVS1 locus in HEK293 cells Top: the human AAVS1 allele. gRNA sequences are designated (g1 and g2) and located upstream of exon 2. Center: donor plasmid is represented schematically. Dashed lines show homology arms (∼800 bp on each side of donor) between genomic locus and plasmid DNA. A splice acceptor sequence is inserted upstream of RFP gene to allow proper RNA splicing using the endogenous transcriptional promoter. T2A sequences are inserted both upstream and between RFP/AncUOX to allow the release of the individual proteins after translation. SV40 poly(A) signal sequence is designated downstream of the donor DNA. Bottom: engineered allele. Post Cas9 cuts at the site corresponding to the gRNA sequences, donor DNA is integrated into the breakpoint through homology directed repair (HDR).

Article Snippet: To construct the pU6-(Bbs1)_CBh-Cas9-T2A-GFP-p2A-Ad4E4orf6 plasmid (CRISPR plasmid), we digested px458 (Addgene, #48138) and pU6-(BbsI)_CBh-Cas9-T2A-mCherry-P2A-Ad4E4orf6 (Addgene, #64222) with FseI/BsrGI (New England Biolabs).

Techniques: CRISPR, Knock-In, Plasmid Preparation, Sequencing